Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families

Background β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. Results In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed β CD59 ) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed β CD128-134 ) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β 0 -thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Conclusion Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.