Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families
Human Genomics(2023)
Abstract
Background β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. Results In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed β CD59 ) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed β CD128-134 ) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β 0 -thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Conclusion Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.
MoreTranslated text
Key words
β-Thalassemia,Novel mutations,β-Thalassemia trait,Premature termination,Truncated peptide
AI Read Science
Must-Reading Tree
Example
![](https://originalfileserver.aminer.cn/sys/aminer/pubs/mrt_preview.jpeg)
Generate MRT to find the research sequence of this paper
Chat Paper
Summary is being generated by the instructions you defined