A Milroy Disease Family Caused by FLT4 Gene Mutation of c.2774 T>A with Phenotypes Heterogeneity

Abstract Background: Milroy disease is a rare, autosomal dominant disorder. Mutations of FLT4 (Fms Related Tyrosine Kinase 4) gene impaired tyrosine kinase signaling, and further cause symptoms of Milroy disease. In this research, we found a large Chinese MD family with phenotype heterogeneities. And we conducted Next Generation Sequencing analysis to explore possible genetic causative factors might be related to clinical heterogeneities among family members.Methods: Sanger sequencing was conducted on the 17-26 exons of FLT4 (NM_182925.4) gene. Primers were as follows: Froward: 5' CTTCATCAGCGTCGAGTGG 3'; Reverse: 5' ATTATGGGCGGGTTCCTT 3'; Next-generation sequencing was conducted to explore pathogenic mutation might lead to phenotype heterogeneities. Then we conducted Sanger sequencing of the possible related genes. The GIMAP7 gene amplification primers as follows: Forward primer: 5’ ACCACCTGCAAGGAAATCAGCCGCT3’; Reverse primer: 5’GTTAGAGAAATACCTCCTTCCCCTT3’. The amplification system for two genes are as follows: 2×Biotech Power PCR Mix: 10µl; forward primer: 0.8µl (10µM); reverse primer: 0.8µl (10µM); DNA template: 1µl (50ng/µl); ddH20: 13.4µl. The effects of the mutations on the gene functions were evaluated with mutation taster and/or SIFT, PolyPhen.Results: A heterozygous substitution mutation was detected in all patients (FLT4 gene: c.2774 T>A, p.V925E). Meanwhile, a G deletion (c.826delG, p.Val276Phefs*29) of GIMAP7 gene was detected in all patients but two patients with phenotype heterogeneities (I1, and II1). Both the two mutations were predicted to be pathogenic.Conclusions: In this report, we described a large Milroy disease family caused by a missense mutation of the FLT4 gene (c.2774 T>A, p.V925E). Meanwhile, a frame-shift mutation (c.826delG, p.Val276Phefs*29) of GIMAP7 gene might be related to the clinical phenotype heterogeneities of the family.