Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA(2)-IIA (vol 11, pg 1047, 2018)
MUCOSAL IMMUNOLOGY（2019）
Abstract
The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.
MoreTranslated text
AI Read Science
Must-Reading Tree
Example
Generate MRT to find the research sequence of this paper
Chat Paper
Summary is being generated by the instructions you defined