University of Groningen A molecular mechanism underlying genotype-specific intrahepatic cholestasis resulting from MYO5B mutations Overeem,

background and rationale for the study: Progressive familial intrahepatic cholestasis (PFIC)6 has been associated with missense but not biallelic nonsense or frameshift mutations in MYO5B, encoding the motor protein myoVb. This genotype-phenotype correlation and the mechanism via which MYO5B mutations give rise to PFIC are not understood. The aim of this study was to determine whether the loss of myoVb or expression of patient-specific myoVb mutants can be causally related to defects in canalicular protein localization and, if so, via which mechanism. Main results: We demonstrate that the cholestasis-associated P660L mutation in myoVb caused the intracellular accumulation of bile canalicular proteins in vesicular compartments. Remarkably, the knockout of MYO5B in vitro and in vivo produced no canalicular localization defects. In contrast, the expression of myoVb mutants consisting of only the tail domain phenocopied the effects of the Myo5b-P660L mutation. Using additional myoVb and rab11a mutants, we demonstrate that motor domain-deficient myoVb inhibited the formation of specialized apical recycling endosomes, and that its disrupting effect on the localization of canalicular proteins was dependent on its interaction with active rab11a and occurred at the trans-Golgi Network/recycling endosome interface. Conclusions: Our results reveal a mechanism via which MYO5B motor domain mutations can cause the mislocalization of canalicular proteins in hepatocytes which, unexpectedly, does not involve myoVb loss-of-function but, as we propose, a rab11amediated gain-of-toxic function. The results explain why biallelic MYO5B mutations that affect the motor domain but not those that eliminate myoVb expression are associated with PFIC6. A cc ep te d A rt ic le © 2019 The Authors. Hepatology published by Wiley Periodicals, Inc. on behalf of American Association for the Study of Liver Diseases Introduction Hepatocytes are polarized epithelial cells with basolateral/ sinusoidal plasma membrane domains that face the blood circulation and apical/ canalicular plasma membranes that form the bile canaliculi via which bile is safely moved out of the liver. Tight junctions separate the sinusoidal and canalicular domains and prevent the mixing of bile and blood. Defects in the polarized distribution or function of cell surface proteins can cause severe liver diseases (1). Of these, progressive familial intrahepatic cholestasis (PFIC) is characterized by the inability of hepatocytes to secrete bile into the canaliculi resulting in the buildup of bile components and liver failure. PFIC can be caused by mutations in different genes (2), including ATP8B1 (PFIC1), ABCB11 (PFIC2), ABCB4 (PFIC3), TJP2 (PFIC4) and NR1H4 (PFIC5). ATP8B1, ABCB11 and ABCB4 encode canalicular membrane transporters. Mutations in these proteins affect their expression, canalicular localization or function and consequently impair bile salt secretion (ABCB11/BSEP) or phospholipid dynamics in the canalicular membrane (ATP8B1, MDR3). NR1H4 encodes the Farnesoid X receptor, a transcription factor that regulates the expression of ABCB11/BSEP. TJP2 encodes the tight junction protein zona occludens (ZO)-2 and mutations in these presumably leads to the leaking of bile out of the canaliculi. Recently, mutations in the MYO5B gene were reported in a group of PFIC patients who presented elevated bilirubin and bile acid levels with normal gamma-glutamyl transpeptidase (GGT) levels and did not have mutations in any of the other PFIC genes (3,4). Unique MYO5B mutations were associated with each affected family. MYO5B encodes the actin-filament based motor protein myoVb. MyoVb binds selected small GTPase rab proteins including the trans-Golgi Network (TGN)and/ or recycling endosome-associated rab8 and rab11a, and has been implicated in apical plasma membrane protein trafficking. Mutations in MYO5B can also cause microvillus inclusion disease (MVID) (5–8), a congenital enteropathy characterized by intractable diarrhea and malabsorption and, at the cellular level, by the mislocalization of apical brush border proteins. Notably, many but not all MVID patients also develop cholestasis leading to liver failure (9). How MYO5B mutations may lead to PFIC is not known. Given the effect of MYO5B mutations on the apical localization of brush border proteins in enterocytes in MVID, it is A cc ep te d A rt ic le © 2019 The Authors. Hepatology published by Wiley Periodicals, Inc. on behalf of American Association for the Study of Liver Diseases possible that myoVb is similarly needed for the correct localization of bile canalicular proteins in hepatocytes and can cause cholestasis when mutated. In vitro studies in the hepatic WIF-B9 cell line, in which the ectopic expression of a rat myoVb tail fragment impaired canalicular protein trafficking (10), may support this hypothesis. In situ studies, however, showing no immunohistochemical abnormalities of canalicular transporters in liver biopsies of some patients with MYO5B mutations presenting severe cholestasis (3,11), challenge this hypothesis. Further, while missense, nonsense and frameshift MYO5B mutations all have been associated with MVID (reviewed in (7)), biallelic nonsense and frameshift mutations predicted to eliminate myoVb expression are noticeably absent in non-MVID cholestasis patients (3,12). Thus, not all pathogenic MYO5B mutations may lead to PFIC and/or canalicular protein localization defects. Notably, causality between patient MYO5B mutations and the mislocalization of bile canalicular proteins in hepatocytes has not been experimentally addressed. The need to decisively determine whether a causal relationship exists between patient-specific MYO5B mutations and canalicular protein localization defects is particularly relevant for PFIC presenting in MVID patients. Indeed, because MVID patients receive life-long total parenteral nutrition (TPN), which itself may induce cholestasis and liver failure (13,14), it is difficult to determine whether liver symptoms in these patients are MYO5B mutationor TPN-induced. The aim of this study was to address the causal relationship between patient MYO5B mutations and canalicular protein mislocalization and to clarify the PFIC disease mechanism in these patients. We demonstrate that myoVb is dispensable for the correct localization of bile canalicular proteins yet can cause cholestasis-associated defects in their localization when mutated via an unexpected mechanism involving the small GTPase rab11a. A cc ep te d A rt ic le © 2019 The Authors. Hepatology published by Wiley Periodicals, Inc. on behalf of American Association for the Study of Liver Diseases Experimental Procedures Cell culture HepG2 cells (ATCC HB8065) were maintained in high-glucose DMEM with 10% heatinactivated fetal calf serum (FCS), 2mM l-glutamine, 100IU/ml penicillin, and 100μg/ml streptomycin in a humidified atmosphere. For experiments, cells were plated on poly-Llysine-coated coverslips and used 3d later. HUES9 cells were maintained on vitronectin in E8 (Thermo-Fisher). Cells were passaged every 4-5 days with 1% RevitaCell Supplement added to the cells overnight on day of passage. Differentiation of HUES9 cells to hepatocytes was as previously described (15). Viral transduction Lentiviral particles were produced using a second-generation system based on pCMVdR8.1 and pVSV-G. 1×106 HEK293T cells were transferred to a poly-L-lysine coated 9cm2 plates in 1.3ml culture medium. 1200ng of lentiviral vector, 1000ng pCMVdR8.1 and 400ng pVSV-G were mixed with 7.8μl Fugene/HD in 200μl Opti-MEM, and added to suspension HEK293T. After overnight incubation, medium was refreshed, and after 48h viral particles were harvested and filtered (0.45μm PVDF membrane filter). 1d after plating, cells were incubated with viral particles for 16h (supplemented with 8μg/mL polybrene). Antibiotics (2.5μg/ml puromycin, 4μg/ml blasticidin) were added 24h after viral incubation. CRISPR knockout A lentiviral CRISPR construct targeting Exon3 of MYO5B was generated using the plentiCRISPR-V2 vector (Addgene#52961) following provided protocols (gRNA target sequence: tcttacggaatccagatatc). Cells were transduced and selected with puromycin as described. Cells were plated on poly-L-lysine coating at 18 cells/cm2 with untreated cells/cm2 as feeder layer. After 4d cells were selected with puromycin (2.5μg/ml) to kill feeder cells, and remaining colonies were isolated as separate lines. To deplete MyoVb A cc ep te d A rt ic le © 2019 The Authors. Hepatology published by Wiley Periodicals, Inc. on behalf of American Association for the Study of Liver Diseases in HUES9 cells, the cells were incubated with MYO5B-targeting lentiCRISPR viral supernatant for 5h (in E8-medium supplemented with 8μg/mL polybrene). After 48h, cells were selected with puromycin (1μg/ml). Selected cells were then plated at 28cells/cm2, and the resulting colonies were mechanically passaged after 3 weeks. Clones were checked for myoVb knockout via Western blot. Plasmids Full-length human myoVb-coding sequence was amplified from HepG2 cDNA through PCR, including a myc-encoding ‘5 overhang in the forward primer sequence. Amplified myc-myoVb was inserted into pENTR1a vectors. All described myoVb mutants were generated by modification of this construct using the Q5® Site-Directed Mutagenesis Kit (NEB), with primers designed in the NEBaseChangerTM tool. MyoVb and thereof derived mutant constructs were transferred to lentiviral vectors for mammalian expression through GatewayTM cloning, using LR-ClonaseTM-II (Thermo-Scientific) as per manufacturer’s instruction. Full-length myc-myoVb constructs were transferred to pLentiCMV-Blast-DEST (706-1) (Addgene#17451), and myc-myoVb tail domain constructs to pLenti-CMV-Puro-DEST (w118-1) (Addgene#17452). EGFP-rab11aWT and EGFPrab11aS25N (16) were gifts from R.E. Pagano (Mayo Clinic, USA). Western blotting Cells were resuspended in RIPA buffer (150mM NaCl, 1% N