Potexvirus Isolates from Creeping Phlox and I railing Portulaca as Strains of Alternanthera Mosaic Virus , and Comparison of the 3 1-Termiflal Portion of the Viral Genomes

Potexvirus isolates from creeping phlox (Phlox stolonjfera) and trailing portulaca (Portulaca grandiflora) obtained from commercial nurseries were found to react strongly with polycloiial antiserum against Papaya mosaic virus (PapMV). Cloning and sequencing of a phlox isolate from Pennsylvania revealed that the coat protein (CP) gene was c.97% identical at the amino acid level to the CP gene sequence of Alternanthera mosaic virus (Geering and Thomas, 1999), and only c.75% to the CF of PapMV. The full genomic sequence of the phlox isolate was then determined. The regions to the 5' of the CF gene were found to be more closely related to (but distinct from) PapMV than to any other characterized potcxvirus. This phlox potexvirus isolate was therefore named AItM V-PA. The host range of AItM V-PA was found to he similar to that of the Australian isolate, AltM V-Au. The 3'-terminal portion of the genome of the portulaca potexvirus isolate, and of additional potexvirus isolates from two phlox cultivars from commercial nurseries in Maryland, were also cloned and sequenced. The sequences of these isolates were similar to those of AItMV-Au and AItMV-PA, and the isolates were designated AItMV-Po (Portulaca), AItMV-SP (creeping phlox 'Sherwood Purple'), and AItMVBR (creeping phlox 'Blue Ridge'). Each of the phlox and portulaca isolates reacted strongly with antiserum to A1tM V-Au, and also with anti-Pap\IV antiserum. The host range of A1tMV includes several ornamentals; these findings suggest that AItMV may be quite widespread, and may be mis-diagnosed as PapMV. INTRODUCTION Creeping phlox (Phlox stolonifera) cv. Sherwood Purple with virus-like symptoms were observed at a commercial nursery in 1997 by Pennsylvania Department of Agriculture inspectors. Representative plants were tested by ELISA fora number of viruses commonly found in ornamental plants, with negative results (Ruth Welliver, PA Dept. of Agriculture, personal communication). Results from further testing by doublestranded RNA analysis and electron microscopy were consistent with the causal virus being a potexvirus, and a basic host range including Nicotiana henthwniana was established (Ruth Welliver, personal communication). Infected plant material was transferred to Beltsville in 1998 under APHIS permit, and the virus further characterized and identified. Indirect ELISA and Western blotting indicated that the phlox potexvirus was serologically related to several well-characterized potexviruses. including Papaya mosaic virus (PapMV), Clover ''el/ow mosaic virus (CY MV). Plantain virus X (PIVX), Potato virus X (PVX). and Potato ozecuba mosaic virus (PAMV): the strongest reaction was obtained to PapMV antiserum (1-lammond et al., 2003). Initial cloning and sequencing of the 3' region of the phlox potexvirus genome indicated c.75% amino acid (aa) identity with the coat protein (CP) of PaPMV, and c.68% nucleotide (iii) identity of the 3' untranslated region (UTR), but c.97% CP aa identity and c.98% 3' UTR nt identity with the available sequence of Alternanthera mosaic virus from Australia (AItMV-Au; AF080448). which was reported to be closely related to, but distinct from PapMV Proc. Xlth IS on Virus Diseases in Omanienlals Ed. C.A. ('hang Acta 1-100. 722, ISIIS 2006 71 (Geering and Thomas, 1999) the phlox potexvirus was therefore identified as an isolate of AItMV (Hammond ci al., 2003), and is now designated AItMV-PA. The complete 6607-nt genomic sequence of AIIMV-PA was then obtained, and found to he more closely related to PapMV than other characterized potexviruses, with identity ranging from c.34% to c.75% in different regions of the genome (Hammond ci al., 2003 and unpublished). Samples of portulaca (Portulaca grandiflora) infected with a potcxvirus tentatively identified as PapMV were being reported by Agdia (see www.agdia.comhesting/positive.results/index.htn-d). We obtained symptomless plants of trailing portulaca from a local Maryland nursery in order to investigate the host range of AItMV. Indirect ELISA tests with PapMV antiserum prior to the intended inoculation were positive, and a potexvirus was transmitted by mechanical inoculation to V. benthamiana. In the spring of 2003 we found symptomatic plants of Phlox stoloni/'ra cultivars 'Blue Ridge', and 'Sherwood Purple' at another local nursery. [LISA testing indicated the presence of potexviruses related to PapMV in each. We therefore decided to clone the 3' portion of the genome of each of these isolates to determine their relationship to AItMV and PapMV. Sequence analysis indicated that each was closely related to AItMV-Au and AItMV-PA, and the isolates were therefore designated AItMV-Po (portulaca), AItMV-BR (phlox 'Blue Ridge') and AILMV-SP (phlox 'Sherwood Purple'. from Maryland). MATERIALS AND METHODS The AItMV-PA isolate (Hammond et al., 2003) obtained from Ruth Welliver. Pennsylvania Department of Agriculture, was maintained in iV hentharniana by periodic mechanical inoculation. AItMV-Po, AItMV-BR, and AItMV-SP were isolated from trailing portulaca, creeping phlox 'Blue Ridge', and creeping phlox 'Sherwood Purple', respectively, from plants obtained from local nurseries-,each was maintained in N. bent hwniana by mechanical inoculation. Virus was readily purified by a procedure initially developed for the potexvirus PIVX (Hammond and Hull, 1981). and modified for potyviruses to include a cesium chloride gradient centrifugation step (Hammond and Lawson, 1988). Host range studies were carried out by mechanical inoculation of sap extracts of infected N. hentha,niana prepared in 1% K2 FIPO4 with a small amount of Celite added as an abrasive. Non-inoculated plants of each species were maintained as negative controls. Inoculated plants were observed for symptom expression over at least three weeks. Inoculated and newly developed upper leaves were assayed by indirect ELISA with a 1:1000 dilution of AItMV-Au polyclonal antiserum (a generous gift of Andrew Geering) essentially according to Jordan and Hammond (1991) using goat anti-rabbit alkaline phosphatase conjugate (Kierkegaard and Perry, Gaithersburg, MD) as the detection antibody. In some instances infection was verified (especially for symptomless infections) by back inoculation to N, bentharniana. Cloning, Sequencing, and Sequence Comparisons Either viral RNA from virion preparations (Hammond and Lawson, 1988), or total RNA prepared from N henthamiana using the RNeasy kit (Qiagen) were used as the template for eDNA production. Reverse transcription of RNA to eDNA was performed using primer, NSNC-odT (5' ATCCATGGCATGCATCGAT 1151 3'). The 3' portion of the genomes of AItMV-PO, AItM V-BR, and AITMV-SF was then amplified using forward primer PP23 (5' AGCCAGGTCAGGTTCAAG 3') paired with primer BNSNC (5' TTTATCGGATCCATGGCATGCATCG 3'), which is extended to the 5' of the nonoligo (dT) portion of primer NSNC-odT. The resulting products were cloned using the TA cloning kit (Invitrogen) following the manufacturer's instruction, and clones of the expected size identified by colony PCR using primers MI3F (5' CCCAGTCACGACGTTGTAAAACG 3') and MI3R (5' AGCGGATAACAATTT CACACAGG 3'). Sequencing was performed using the BigDye 3.1 Sequencing kit r