Evaluation of eNOS gene polymorphisms in relation to BMD in postmenopausal women

Results None of the SNPs of the eNOS gene was significantly associated with BMD at the lumbar spine, femoral neck, Ward's triangle and femoral trochanter in the combined group. Mean BMD values were therefore found to be similar across the genotypes in postmenopausal Turkish women. However, there was a significant association between the T −786 C polymorphism and BMD values at the lumbar spine in the normal control group ( P = 0.005), and at the femoral trochanter in the osteoporotic patients ( P = 0.046). The mean value of the lumbar spine BMD in the normal controls was significantly higher in women with the TC genotype of the T −786 C polymorphism than in women with the TT genotype ( P = 0.0012). Women with the CC genotype of the T −786 C polymorphism in the osteoporotic patients had significantly higher BMD value at the femoral trochanter than those with the TC ( P = 0.018) and TT genotypes ( P = 0.024). Frequencies of the TC heterozygotes for T −786 C polymorphism were significantly higher among osteoporotic subjects than normal controls. Also, the CC and TT genotype frequencies of control group were significantly higher than those of the osteoporotic group at the femoral neck. Conclusions We conclude that, although the biological role of the nitric oxide synthases is well established, our study does not suggest that eNOS gene polymorphisms, T −786 C and Glu298Asp, are major contributors to adult bone mineral density in the postmenopausal Turkish women. Keywords BMD Polymorphism Postmenopausal eNOS 1 Introduction Osteoporosis is a multifactorial disease, characterized with a low bone mineral density and deterioration in bone microarchitecture predisposing individuals to an increased risk of bone fracture [1,2] . It is well known that hormonal and environmental factors are strongly associated with the development of osteoporosis. In addition, heritability studies showed that bone mineral density and structure could be mainly predicted by genetic factors from 45 to 80% [3] . Over the last few years a number of genes coding calciotrophic hormones and receptors, bone matrix components and bone metabolism regulators have been implicated as having a potential role in the determination of BMD and the risk of osteoporotic fracture [4] . Strong associations between the risk of osteoporosis and specific polymorphisms of the VDR , ESR1 and COL1A1 genes have been shown repeatedly [5] . Loss of estrogen's protective effect on the skeleton is believed to play an important role in the development of postmenopausal osteoporosis. Other regulatory factors may also be involved. One likely candidate is nitric oxide (NO), which is known to be produced in bone by both constitutive and inducible forms of NO synthase (NOS), inhibits osteoclastic bone resorption in vitro and regulates bone remodeling in vivo [6,7] . Wimalawansa et al. have shown that NO can slow bone loss in humans [8] . Effects of NO reported in vitro indicate that it may enhance osteoblast function. NO also alters osteoclast indices in vitro : osteoclastic resorption is potentiated during NOS inhibition [9] . Later studies suggested that endothelial NOS (eNOS) may be preferentially involved in mediating estrogen's effects on osteoblast. There have been several studies on osteoporosis-related genes using cell culture and animal models. eNOS is one such gene that contains 26 exons spanning about 21 kb of genomic DNA and is mapped on chromosome 7q36 [10] . Samuels et al. reported about the estrogen-induced bone formation mediated by eNOS in female mice [11] . Loveridge et al. assessed the expression of the NO synthase eNOS in osteocytes from the femoral neck cortex and found that the proportion of osteocytes expressing eNOS was decreased in the femoral neck hip fracture cases compared with controls [12] . A later study carried out by Cabalero-Alias et al. confirmed this finding [13] . Several polymorphisms of the eNOS gene, such as T −786 C, A −922 T, T −1486 A and G 894 T, have been reported to be associated with human disease [14] . Since the eNOS protein plays an important role in the control of bone resorption, functional polymorphism of this gene might be a susceptibility factor for osteoporosis. The purpose of the present study was to evaluate possible associations between two functional polymorphisms of the eNOS gene, T −786 C, a single nucleotide polymorphism in promoter region, and Glu298Asp (G894T) in exon 7, and BMD in postmenopausal osteoporosis. 2 Materials and methods 2.1 Study population A total of 616 postmenopausal Turkish women aged between 45 and 65 years old, referred for screening of osteoporosis to the University Hospital of Osteoporosis Unit of the Department of Physical Medicine and Rehabilitation, Faculty of Medicine, Akdeniz University, Antalya, Turkey, agreed to participate in a case–control study consisting of osteoporotic and normal groups. The details of the study were fully explained by the study coordinator and written informed consent to participate in the study, as required by the Faculty ethics committee, was obtained from all the participants before enrollment into the study. Participants’ confidentiality was maintained. Ethical approval has been obtained for the conduct of study from the Medical ethics Committee of Akdeniz University Medical Faculty. Thereafter, a questionnaire was applied at the baseline and/or second examination to collect data on participant’ demographic information, self-reported fracture history, health status, smoking habits, history of hypertension, diabetes, coronary heart disease, or stroke. Anthropometric measurements assessed at baseline included weight, height, years since menopause, age and body mass index. Body mass index (BMI) was calculated as weight in kg divided by the height (in meters) squared. Cases were divided into two groups according to BMD values. The osteoporotic group consisted of 311 women with primary postmenopausal osteoporosis ( t -score of the lumbar spine or total hip was −2.5 or less). The normal control group was comprised of 305 age-matched women without osteporosis showing normal BMD values ( t -score of the lumbar spine or total hip was −1.0 or higher). The basic characteristics of the osteoporotic patients and normal controls are presented in Table 1 . Women with a history of early or late menarche or premature menopause (before 45 years of age) and with clearly undefined menopausal status or markedly irregular menstrual periods were excluded from the study. Participants with a previous diagnosis of osteoporosis or treatment for metabolic bone disorders, having self-reported fracture history or diseases known to effect bone metabolism and/or oxidant–antioxidant status like diabetes, thyroid diseases, neurological and inflammatory diseases, hepatic and renal diseases using antioxidant supplementations like antioxidant vitamins, special diets or potent herbal medicines within the 6 months prior to enrollment were excluded. Other exclusion criteria were women with a self-reported history of hip, wrist or spine fracture, women with diseases known to effect bone metabolism, hepatic and renal diseases and neurological and inflammatory rheumatic diseases, women who reported use of antioxidant supplementations, vitamin D, calcitonin, antidepressant, conjugated estrogen, progestin, reloxifene or tamoxifen within 6 months of study entry and women who were treated with corticosteroids within 3 months of study entry. 2.2 Bone mineral density analysis All the study participants had bone mineral density (BMD) determined at the lumbar spine (L2–L4) and the standard sites at the hip: femoral neck, trochanter and Ward's triangle using dual energy X-ray absorptiometry (DXA, Norland XR-36). Values for results of DXA densitometer were expressed as BMD (g/cm 2 ). Women with a t -score −2.5 or less on L2–L4 or femur neck or total femur were accepted as having postmenopausal osteoporosis. The non-osteoporotic control group consisted women with a t -score −1.0 or greater on these sites. 311 postmenopausal females, who were detected to have osteoporosis ( t -score of the lumbar spine or total hip was −2.5 or less) and 305 control postmenopausal females ( t -score of the lumbar spine or total hip was −1.0 or higher) were entered into the study. 2.3 DNA analyses Peripheral blood samples for DNA extraction from all participants were obtained in K 3 EDTA tubes and were stored at 4 °C until analysed. Two single nucleotide polymorphisms (SNPs) were selected in this study. One was situated in the eNOS promoter region (T −786 C) and the other in exon 7 (Glu298Asp). Genotyping of each polymorphism was performed by polymerase chain reaction (PCR) to confirm presence or absence of the eNOS gene using the following oligonucleotide primers: (forward) 5′ATGCTCCCACCAGGGCATCA3′ (reverse) 5′GTCCTTGAGTCTGACATTA3′ for the T −786 C polymorphism and (forward) 5′AAGGCAGGAGACAGTGGATGGA3′ (reverse) 5′CCCAGTCAATCCCTTTGGTGCTCA3′ for the Glu298Asp polymorphism. For each PCR, 100 ng purified human genomic DNA was amplified in a reaction volume of 25 μl. The reaction for amplifying the genotypes was initially denatured at 94 °C for 3 min (T −786 C) or for 5 min (Glu298Asp). This step was followed by 35 cycles of denaturation at 94 °C for 45 s (T −786 C) or 40 cycles at 94 °C for 1 min (Glu298Asp), annealing at 60 °C for 45 s (T −786 C) or 61 °C for 1 min (Glu298Asp), and extension at 72 °C for 1 min. The reaction was ended with a final extension at 72 °C for 3 min (T −786 C) or 72 °C for 5 min (Glu298Asp). PCR products were digested with 5 units of MspI and BanII restriction endonucleases for T −786 C and Glu298Asp polymorphisms, respectively (Fermentas Life Sciences) and incubated overnight at 37 °C. Digestion products of the T −786 C and Glu298Asp genotypes were visualized on 2% agarose gels stained with ethidium bromide. Internal controls were used in each digestion for exclusion of the in adequate enzymatic digestion as internal quality control. 2.4 Statistical methods Age, height, weight, years since menopause, body mass index, and the DXA variables (BMD values at various sites) were recorded. All these variables were normally distributed and comparisons were made between osteoporotic and normal control groups in baseline characteristics using Student's t -tests. However, the generalized linear model (GLM) procedure was used to compare sample mean BMD values at various sites by different genotype classifications of the eNOS polymorphisms, T −786 C and Glu298Asp in the combined group (consisting of both osteoporotic and control groups) and the osteoporotic and control groups separately: most classes showed no significant differences. Some classes revealed differences that were statistically significant. In cases in which the GLM procedure was significant, Tukey's posttest was used for multiple comparisons. In all GLM analyses, the continuous variables of age and BMI, which generally have significant effects on the BMD variations, were used as covariates to adjust the raw BMD values. By performing the Kolmogorov–Smirnov test, the BMD data in our samples were verified for normal distribution. Levene's test was used to test the homoscedasticity of variances. Agreement of genotype frequencies of eNOS polymorphisms with Hardy–Weinberg (H–W) ratios was tested using the Chi-squared goodness-of-fit test in the osteoporotic and control groups, respectively. H–W ratios are the ratios of genotypes that involve when mating is random and neither selection nor drift are operating in a large population. For two alleles (H and h) with frequencies p and q , the H–W frequencies for the three genotypes (HH, Hh and hh) are p 2 , 2 pq and q 2 , respectively. The frequencies of alleles and genotypes in the population would remain the same from one generation to next. Genotype frequencies of eNOS polymorphisms were calculated and the Chi-squared goodness-of-fit test is used to analyse whether the observed genotype frequencies are different from expected genotype frequencies. The level of statistical significance was set at 5%; the P -value of less than 0.05 was considered statistically significant. The statistical software used for the analyses was the Statistics Package for Social Sciences version 11.0 (SPSS Inc., Chicago, IL). Results are expressed as mean ± SEM differences. 3 Results 3.1 Basic descriptive statistics of the subjects The basic descriptive statistics of the 311 osteoporotic patients and the 305 normal controls are presented in Table 1 . The BMD values for all sides follow the normal distribution in both groups. Patients with osteoporosis were older, smaller, thinner and menopause onset was earlier ( P < 0.0001). The mean age of the participants was 57.540 ± 0.416 years for the osteoporotic group and 52.760 ± 0.353 for the control group, and the mean years since menopause (YSM) was 8.638 ± 0.238 years for the osteoporotic group and 5.856 ± 0.239 for the control group ( Table 1 ). BMD values measured with the Lunar equipment at the lumbar spine, femoral neck, Ward's triangle and femoral trochanter were significantly greater in the normal control group than those measured in the osteoporotic group ( P < 0.0001 for all). 3.2 Bone mineral density by genotypes of the eNOS polymorphisms Table 2 shows the mean bone mineral density at the lumbar spine, femoral neck, Ward's triangle and femoral trochanter in the combined group consisting of both osteoporotic patients and normal controls with different genotypes of the T −786 C and Glu298Asp polymorphisms. It can be easily seen from this table that none of the SNPs of the eNOS gene was significantly associated with BMD at the lumbar spine, femoral neck, Ward's triangle and femoral trochanter. There were no significant genotypic differences with regard to the BMD values at all sites measured in the combined group. Mean BMD values were therefore found to be similar across the genotypes in postmenopausal Turkish women. The mean bone mineral densities at the lumbar spine, femoral neck, Ward's triangle and femoral trochanter in the osteoporotic patients and normal controls with different genotypes of the T −786 C and Glu298Asp in postmenopausal Turkish women are shown in Table 3 . It is evident from this table that there is a significant association between the T −786 C polymorphism and BMD values at the lumbar spine in the normal control group ( P = 0.005), and at the femoral trochanter in the osteoporotic patients ( P = 0.046). No other significant association with BMD was observed. The mean value of the lumbar spine BMD in the normal controls was significantly higher in women with the TC genotype of the T −786 C polymorphism than in women with the TT genotype ( P = 0.0012). Women with the CC genotype of the T −786 C polymorphism in the osteoporotic patients had significantly higher BMD value at the femoral trochanter than those with the TC ( P = 0.018) and TT genotypes ( P = 0.024). There were no other significant genotypic differences with regard to the mean BMD values at all sites measured both in the osteoporotic patients and normal controls. 3.3 Distribution of the selected eNOS polymorphisms Genotype frequencies of the eNOS polymorphisms, T −786 C and Glu298Asp, at the lumbar spine and femoral neck in osteoporotic and normal control postmenopausal Turkish women are shown in Table 4 . There were no significant deviations from the Hardy–Weinberg equilibrium (HWE) for the Glu298Asp and T −786 C polymorphisms in both osteoporotic and normal control groups ( P > 0.05). Osteoporotic–control genotypic association analysis of eNOS polymorphisms and lumbar spine and femoral neck BMD in postmenopausal Turkish women are also shown in Table 4 . There were significant differences only in the genotype frequencies of T −786 C polymorphism between osteoporotic and control groups at the femoral neck ( P = 0.012). Notably, frequencies of the TC heterozygotes were significantly higher among osteoporotic subjects than normal controls. However, the CC and TT genotype frequencies of control group were significantly higher than those of the osteoporotic group at the femoral neck. No association was detected between the genotypes of T −786 C polymorphism and lumbar spine BMD. Similarly, the Glu298Asp polymorphism was not associated with the femoral neck and lumbar spine BMD. For this polymorphism there was no significant difference in the genotype distribution between osteoporotic and control groups at both the sites. 4 Discussion The aim of this study was to evaluate T −786 C and Glu298Asp polymorphisms of the eNOS gene in the 616 postmenopausal Turkish women as they are associated with bone traits such as spine and femur BMDs. The T −786 C polymorphism is located in promoter region and the Glu298Asp polymorphism in exon 7 of the eNOS gene. To our knowledge this is the first report, presenting differences in distribution of the eNOS gene polymorphisms between postmenopausal osteoporotic woman and age-matched control cases. In this study, we detected differences in the genotype frequencies of T −786 C polymorphism between osteoporotic and control groups at the femoral neck. Frequencies of the TC heterozygotes were significantly higher among osteoporotic subjects than normal controls. However, TT genotype frequency of control group was significantly higher than that of the osteoporotic group at the femoral neck. The results indicate that the TC genotype might be associated with elevated risk of postmenopausal osteoporosis. This association must be confirmed by further studies. However, we could not find any significant difference in the genotype distribution of Glu298Asp polymorphism between osteoporotic and control groups at both the sites. A previous study by Taylor et al. failed to demonstrate an association between the eNOS polymorphism, Glu298Asp, in osteoporotic fracture and BMD. They found a relatively small association between the eNOS genotypes and hip fracture [15] . Also, Cho et al. investigated eighteen polymorphisms including Glu298Asp and found out that the Glu298Asp polymorphism was not associated with BMD [16] . T −786 C polymorphism was not evaluated in both of these studies. Also, most of the polymorphisms evaluated in the study performed by Cho et al. were intronic nucleotide alterations with no known effects on expression or function of the eNOS protein. The main differences between these two studies are that Taylor et al. used a sample including only older white women and evaluated a single polymorphism, however, Cho et al. employed a sample consisting of both men and women from a general population of Caucasians and evaluated multiple polymorphisms. Cho et al. excluded the participants who used nitrate and/or osteoporosis medications in their study as in our study while the Taylor et al. did not exlude. Another difference is that Cho et al. adjusted bone density/ultrasound and geometry measures for age, BMI, height and estrogen status, while Taylor et al. did not include the same variables in their models and did not attempt to adjust for multiple comparisons. To the best of our knowledge, the current study is the first to examine in detail the association between the T −786 C polymorphism in addition to the Glu298Asp polymorphism of the eNOS gene and BMD at various skeletal sites in a case–control setting. Our study has a strong point in which a quantitative bone-related trait, BMD adjusted for age and BMI, was measured at several clinically important skeletal sides including lumbar spine, femoral neck, Ward's triangle and femoral trochanter. The data demonstrated no association between the eNOS polymorphisms and BMD at all these sites in the combined group consisting of both osteoporotic patients and normal controls in postmenopausal Turkish female. However, there was a significant association between the T −786 C polymorphism and BMD values at the lumbar spine in the normal control group, and at the femoral trochanter in the osteoporotic patients. We found that individuals with the TC genotype of the T −786 C polymorphism in the normal controls had the highest BMD at the lumbar spine and the CC genotype of the same polymorphism was associated with higher BMD at the femoral trochanter in the osteoporotic females. There were no other significant genotypic differences with regard to the mean BMD values at all sites measured both in the osteoporotic patients and normal controls. Our findings did not confirm strong or consistent associations between the T −786 C and Glu298Asp genotypes and BMD in both combined and separate groups. Combining the osteoporotic patients and normal controls did not improve the association and only the combined genotypes of T −786 C and Glu298Asp were differently distributed. One of this study's strong points is the homogeneous characteristics of the participants. All of the postmenopausal women participated in the study were of a similar age and socio-geographic origin. This guarantees against false positive results due to population admixture. Another strong point is that analyses of the BMD were carried out at the same unit, by the same technician using the same device. Furthermore, genetic studies of osteoporosis have mainly been performed using single polymorphism in individual genes. However, this study has investigated the associations of two polymorphisms in the eNOS gene with BMD. We did not study all known polymorphisms of the eNOS gene, however, the polymorphisms that were analysed in this study affect expression levels and enzymatic activity of eNOS protein. We conclude that, although the biological role of the nitric oxide synthases is well established, our study does not suggest that eNOS gene polymorphisms, T −786 C and Glu298Asp, are major contributors to adult bone mineral density in the postmenopausal Turkish women. Further studies will be needed to investigate the associations between these polymorphisms and other bone-related phenotypes. Acknowledgement This study was supported by The Scientific Research Projects Unit of Akdeniz University, Antalya, Turkey. References [1] E.M. Lau C. Cooper Risk factors for osteoporosis in Europe J Bone Miner Metab 19 2001 142 145 [2] Y. Giguère F. Rousseau The genetics of osteoporosis: ‘complexities and difficulties’ Clin Genet 57 2000 161 169 [3] J.A. Eisman Pharmacogenetics of the vitamin D receptor and osteoporosis Drug Metab Dispos 29 2001 505 512 [4] K. Zajickova I. Zofkova Osteoporosis: genetic analysis of multifactorial disease Endocr Regul 37 2003 31 44 [5] F.M. Williams T.D. Spector The genetics of osteoporosis Acta Reumatol Port 32 2007 231 240 [6] D.M. Evans S.H. Ralston Nitric oxide and bone J Bone Miner Res 11 1996 300 305 [7] X. Fan E. Roy L. Zhu Nitric oxide regulates receptor activator of nuclear factor-kappaB ligand and osteoprotegerin expression in bone marrow stromal cells Endocrinology 145 2003 751 759 [8] S.M. Wimalawansa V.S. Shankar D.J. Simmins S.J. Wimalawansa The mechanism of bone resorption by cyclosporin: involvement of the NO-cGMP pathway J Musculoskelet Neuronal Interact 1 2000 141 143 [9] T.P. Kasten P. Collin-Osdoby N. Patel Potentiation of osteoclast bone-resorption activity by inhibition of nitric oxide synthase Proc Natl Acad Sci USA 91 1994 3569 3573 [10] P.A. Marsden H.H. Heng S.W. Scherer Structure and chromosomal localization of the human constitutive endothelial nitric oxide synthase gene J Biol Chem 268 1993 17478 17488 [11] A. Samuels M.J. Perry R.L. Gibson S. Colley J.H. Tobias Role of endothelial nitric oxide synthase in estrogen-induced osteogenesis Bone 29 2001 24 29 [12] N. Loveridge S. Fletcher J. Power Patterns of osteocytic endothelial nitric oxide synthase expression in the femoral neck cortex: differences between cases of intracapsular hip fracture and controls Bone 30 2002 866 871 [13] A.M. Caballero-Alías N. Loveridge A. Pitsillides Osteocytic expression of constitutive NO synthase isoforms in the femoral neck cortex: a case–control study of intracapsular hip fracture J Bone Miner Res 20 2005 268 273 [14] M.E. Gerritsen Genetic variations in vascular endothelial growth factor and endothelial nitric oxide synthase and their contributions to human disease Microcirculation 12 2005 129 140 [15] B.C. Taylor P.J. Schreiner J.M. Zmuda Association of endothelial nitric oxide synthase genotypes with bone mineral density, bone loss, hip structure, and risk of fracture in older women: the SOF study Bone 39 2006 174 180 [16] K. Cho S. Demissie J. Dupuis Polymorphisms in the endothelial nitric oxide synthase gene and bone density/ultrasound and geometry in humans Bone 42 2008 53 60