Viral factors influencing the outcome of human cytomegalovirus infection in liver transplant recipients

Study design The value of valganciclovir prophylaxis and laboratory-guided preemptive therapy for the prevention of CMV infection and disease was observed in 64 OLT recipients. Prophylaxis was given to all CMV seronegative recipients receiving a liver from a seropositive donor (D+R−; n = 15), and all other recipients were randomised to receive either prophylaxis ( n = 24) or laboratory-guided preemptive therapy ( n = 25). Recipients were monitored for CMV DNAemia, viral load, emergence of antiviral resistant strains and co-infections. Results CMV end-organ disease and antiviral resistant strains only occurred in D+R− recipients despite the use of prophylaxis in these patients. The D+R− recipients commencing prophylaxis immediately following transplantation had better outcomes compared to those for whom prophylaxis was delayed due to renal impairment. Prophylaxis reduced the incidence of CMV DNAemia, persistent infection, and high viral loads for CMV seropositive (D−R+and D+R+) recipients, but laboratory-guided preemptive therapy effectively controlled CMV infection and prevented disease in these OLT recipients. Conclusion Delaying the commencement of valganciclovir prophylaxis may be associated with worse outcomes for high-risk OLT recipients. Laboratory-guided pre-emptive therapy remains an alternative approach for seropositive recipients at lower risk of CMV disease. Abbreviations CMV cytomegalovirus DNA deoxyribonucleic acid HHV human herpesvirus OLT orthotopic liver transplantation PCR polymerase chain reaction D donor R recipient valGCV valganciclovir Keywords Cytomegalovirus Liver transplantation Prophylaxis Antiviral agents 1 Background Human cytomegalovirus (CMV) is one of the most common opportunistic viral infections following orthotopic liver transplantation (OLT), causing life-threatening illness in 5–10% of recipients. 1–4 The viral factors associated with clinical outcome of CMV infection post-OLT include initial viral load, replication kinetics and emergence of antiviral resistant strains. 5–9 Other viral characteristics postulated to influence the course of post-OLT infection include CMV genotype, 10 co-infection with multiple CMV strains 11,12 and co-infection with other herpesviruses, particularly human herpesvirus (HHV)-6 and HHV-7. 13,14 However, the major determinant of post-OLT outcomes remains recipient serostatus, with CMV seronegative recipients of an organ from a CMV seropositive donor (D+R−) at highest risk for CMV infection and disease. 4,15 Most transplant centres use valganciclovir (valGCV) for the prevention of CMV-related disease in OLT recipients, either prophylactically following transplantation, or preemptively on the basis of laboratory and clinical indicators of active CMV infection. 16–21 However, long term GCV therapy increases the risk of haematological toxicity, 22 potential sterility, 23 and emergence of antiviral resistant strains. 7,24 Monitoring of viral load followed by preemptive therapy may be a better alternative for OLT recipients with lower risk of CMV infection and disease. 20 However, the success of preemptive therapy is heavily reliant on rapid, accurate and predictive diagnostic assays for CMV. 19,25 CMV-related disease still occurs in 2–14% of OLT recipients, which suggests optimum strategies for prophylaxis and preemptive therapy are yet to be achieved. 2–4,16,17,19,26 Antiviral resistant CMV strains also continue to emerge in 2–10% of treated solid organ transplant recipients. 7,27–31 We undertook a five-year randomised study examining the efficacy of valGCV prophylaxis and preemptive therapy for prevention of CMV infection and disease following OLT at a tertiary referral hospital in Melbourne, Australia. We examined the importance of viral load, CMV genotype, antiviral resistance, herpesvirus co-infections, and host factors such as pre-transplant serostatus. The timing of valGCV prophylaxis and accurate CMV diagnosis are important parameters influencing the outcome of CMV infection following OLT, particularly for patients at high-risk for CMV infection and disease. 2 Objectives Examine viral factors that influence CMV infection outcomes following valganciclovir prophylaxis or laboratory-guided preemptive therapy in OLT recipients. 3 Study design 3.1 Recruitment and randomisation Adults undergoing OLT at the Liver Transplant Unit, Austin Health were recruited to a randomised study comparing valGCV prophylaxis with laboratory-guided preemptive therapy. The study was approved by the relevant ethics committees (Austin Health 01943, SESIAHS 06/029 and UNSW 06145) and patient consent obtained from all participants. Donor (D) and recipient (R) serostatus were determined pre-transplant. It is well established that prophylaxis is important in reducing the incidence of CMV infection and disease in high-risk solid organ transplant recipients. 16–18 Accordingly, all D+R− recipients received valGCV prophylaxis in this study. All other recipients were randomised by factorial assignment to either the prophylaxis arm, where participants received 900 mg/day valGCV for 100 days within 72 h of transplantation, with weekly CMV monitoring used to determine the need for extended prophylaxis or additional therapy, or the preemptive therapy arm, where no prophylaxis was given, and CMV monitoring was used to determine the need for preemptive valGCV therapy. Prophylaxis was delayed, or the dosage reduced to 450 mg/day, where renal impairment occurred post-transplant (creatinine clearance <60 ml/min), until function improved. All recipients received immunosuppressive therapy consisting of azathioprine or mycophenolate mofitil, with Prograf or Neoral and prednisolone, with dosage adjustment as required. 3.2 Patient monitoring and antiviral therapy All participants were monitored for CMV infection by testing blood specimens taken weekly up to 12 weeks post-transplant, and every month up to 18 months post-transplant. Upon laboratory or clinical indication of active CMV infection, participants in the preemptive arm were given valGCV (900 mg/day) for at least two weeks or until symptoms resolved. ValGCV was continued beyond 100 days for participants with laboratory or clinical indicators of active CMV infection during prophylaxis, or recommenced if infection was evident following prophylaxis. Evidence of active CMV infection included two or more consecutive PCR-positive specimens; seroconversion or CMV detection in a previously seronegative individual; histopathological detection; or development of clinical symptoms consistent with CMV-related disease. 3.3 Qualitative CMV PCR All specimens were screened for the presence of CMV DNA by MIE nested PCR, as previously described. 32,33 3.4 Real-time CMV PCR CMV DNA load was quantified for all CMV PCR-positive specimens by real-time PCR. The assay was based on the qualitative CMV MIE PCR 32,33 using LC Faststart DNA master SYBR green I reagents and Lightcycler™ 2.0 (Roche Diagnostics, USA), following manufacturer's instructions. 3.5 CMV genotyping Multiple CMV strain infections were identified by glycoprotein B (gB) genotyping using a multiplex PCR. 34 PCR-sequencing of CMV genes, UL97 and UL54, was also carried out for identification of antiviral resistant strains, as previously described. 24,35 3.6 HHV-6, HHV-7 and HHV-8 PCR HHV-7 and HHV-8 were detected using a multiplex PCR as described previously. 36 HHV-6A and HHV-6B were detected with a semi-nested PCR using primers H6-1319 (5′ CAAGCCCTAACTGTGTATGTACAG 3′) and H6-2353 (5′ AGGAGTGACCTCTGGTGGTG 3′), and then H6-1319 and H6-1751 (5′ CTCATAAGGTGCTGAGTGATCAG 3′) in separate rounds of amplification. First round PCR conditions consisted of 1x buffer, 3 mM MgCl 2 , 0.2 mM dNTP mix, 0.4 μM primers, 0.5U GoTaq DNA polymerase (Promega Corporation, USA) and 5 μl of extracted DNA, subject to 95 °C for 3 min, 30 cycles of (94 °C for 30 s, 58 °C for 30 s, 72 °C for 40 s), and 72 °C for 3 min. In the second round of PCR, 2.5 mM MgCl 2 and 1 μl first round PCR product were added to the reaction mix, and 59 °C annealing temperature was used. HHV-6A and HHV-6B identification was based on size differentiation (230 versus 455 base pairs (bp), respectively) following gel electrophoresis. 3.7 HHV-6 antiviral resistance HHV-6 U69 was amplified from HHV-6 PCR-positive DNA following published methods. 37 The U69 PCR product was sequenced and analysed for the presence of mutations consistent with antiviral resistance. 3.8 Statistics Differences between groups were compared using the chi-square test or Fisher's exact test ( n < 5), with p < 0.05 considered statistically significant. 4 Results 4.1 CMV infection and disease in D+R− OLT recipients receiving antiviral prophylaxis Despite receiving prophylaxis, most (80%) D+R− recipients were infected with CMV post-transplant, and over half developed a persistent CMV infection with high viral load ( Table 1 ). DNAemia usually developed following cessation of prophylaxis, but persistent infection was detected during prophylaxis for 5/15 recipients. CMV infection progressed to clinical disease for 3/15 D+R− recipients. One patient given valGCV prophylaxis immediately following transplantation, developed CMV hepatitis post-prophylaxis and later died of liver failure despite receiving intravenous GCV (5 mg/kg/twice daily) for 10 days from day 134 post-OLT. One patient developed CMV colitis at day 41 post-OLT, concurrent with commencement of prophylaxis, which resulted in resolution of the disease. Another patient commenced prophylaxis at day 17 post-OLT, but despite extension of prophylaxis developed CMV gastritis and duodenitis at day 187 post-transplantation. This patient was treated with dual valGCV (900 mg/day) and foscarnet (60 mg/kg 3×/day) therapy for one month but died of multi-organ failure. Higher, but non-significant, rates of active CMV infection ( p = 0.123, Fisher's Exact test) and disease ( p = 0.446) were observed in D+R− recipients for whom prophylaxis was delayed for greater than seven days because of renal impairment post-OLT ( Table 1 ). Two of these recipients were CMV PCR-positive prior to, and following, delayed prophylaxis. Delay in prophylaxis was significantly associated with increased detection of antiviral resistant CMV ( p = 0.026), although only 1/4 of these resistant infections was associated with clinical disease. D+R− recipients were the only OLT recipients to develop CMV-related disease or antiviral resistant infections in this study. 4.2 The efficacy of valGCV prophylaxis versus preemptive therapy in CMV seropositive OLT recipients The efficacy of valGCV prophylaxis versus preemptive therapy is best assessed by comparison of CMV infection and disease in seropositive (D−R+ and D+R+) OLT recipients ( Table 2 ). Single episodes of CMV DNAemia were fewer in the prophylaxis arm of the study, and persistent CMV infection was significantly reduced in D−R+ and D+R+ recipients receiving valGCV prophylaxis compared with preemptive therapy ( p = 0.02, Chi-square test). High viral loads (>10 3 copies/ml) were present in over 50% of seropositive recipients in the preemptive arm of the study, but were not evident for D−R+ recipients, and uncommon for D+R+ recipients, receiving prophylaxis. Seven of the 12 OLT-recipients in the preemptive therapy arm with persistent CMV infection were given valGCV for four weeks, leading to resolution of DNAemia for all treated patients. CMV DNAemia resolved without antiviral treatment for the other five recipients with low-level persistent CMV infection. Therefore, although the incidence of CMV infection was high for recipients in the preemptive arm of the study, antiviral intervention or host immune response was sufficient to prevent progression to CMV-related disease following active infection. Overall, CMV-related disease was not evident, and antiviral resistant CMV not detected, in any of these “lower risk” recipients, regardless of the antiviral strategy employed. 4.3 The influence of multiple CMV genotype infections There was no significant difference in multiple CMV genotype infections between patients treated preemptively or prophylactically ( p = 0.187, Chi-square test). Infection with two or more gB genotypes was mostly found in D+R+ recipients ( Table 2 ), presumably representative of donor-derived virus co-circulating with reactivated CMV in the recipient. These co-infections were not associated with increased viral load or CMV-related disease, and were not clinically disadvantageous to the infected recipient. 4.4 HHV-6, HHV-7 and HHV-8 infections post-liver transplantation Intermittent HHV-6B and HHV-7 infections were detected in approximately 25% of OLT recipients ( Table 3 ), but these infections were not associated with end-organ disease. Prophylaxis with valGCV had no discernible effect on HHV-6 and HHV-7 incidence post-OLT, and antiviral resistant genotypes were not detected. Concomitant CMV, HHV-6 and HHV-7 infections were detected in 5–10% of recipients, with no association between co-infection and CMV-related disease. 5 Discussion Transplantation from seropositive donors to seronegative recipients (D+R−) continues to be the major risk factor for development of CMV disease post-OLT, despite valGCV prophylaxis. Although insignificant due to low numbers, our results show delayed initiation of prophylaxis potentially contributes to worse outcomes for these recipients, and early, reduced dosage of valGCV may be a better strategy for prevention of CMV in recipients with renal impairment. The shortage of CMV seronegative donors means D+R− transplants will continue to be necessary, and antiviral prophylaxis remains the optimal strategy for the prevention of CMV disease within this high-risk group. Emergence of CMV infection and development of late-onset disease often occurs after the cessation of prophylaxis. 4,16,38 We found three D+R− and five D+R+ recipients with CMV DNAemia during prophylaxis, and progression to CMV-related disease in one patient at the commencement of prophylaxis. However, the overall incidence of CMV disease for OLT recipients receiving valGCV prophylaxis was relatively low (7.6%), consistent with disease rates in other studies, and much lower than another study with a disease incidence of 22.2%. 4,16,39 The use of accurate and rapid diagnostic assays for detection of CMV is a major determinant of success for laboratory-guided preemptive therapy post-transplantation. 19 Initiation of preemptive therapy based on persistent CMV infection was a successful strategy in this study, eliminating CMV disease in lower risk recipients (D−R−, D−R+ and D+R+). Rapid increases in CMV load have been shown to correlate with increased risk of CMV disease, and values of 10 3 –10 5 CMV copies/ml in blood have been used as laboratory indicators for initiation of antiviral therapy. 5,6,20 In this study, CMV disease and antiviral resistance occurred only in recipients with CMV >10 3 copies/ml. Innate and adaptive immune responses are likely to influence outcomes of CMV infection post-OLT. Despite the immunosuppressive regimens given following transplantation, recipients have been shown to mount CMV-specific CD4+ and CD8+ T cells responses, the level and complexity of which may influence viral replication and progression to disease. 5,40,41 Further investigation may provide immunotherapies that can be used in conjunction with antiviral prophylaxis and preemptive therapy to prevent CMV disease in high-risk D+R− OLT recipients. Conflict of interest No conflict of interest. Ethical approval This study was approved by the ethics committees of Austin Health (01943), SESIAHS (06/029) and UNSW (06145). Acknowledgements The technical assistance of Zubair Waliuzzaman, Nikolas Rismanto and Catherine Smith and financial support of Roche Products , Australia is acknowledged with appreciation. This study is registered by ANZCTR ( http://www.ANZCTR.org.au/ACTRN12610000787088.aspx ) ACTRN: ACTRN12610000787088. References 1 V.C. Emery A.V. Cope C.A. Sabin A.K. Burroughs K. Rolles T. Lazzarotto Relationship between IgM antibody to human cytomegalovirus, virus load, donor and recipient serostatus, and administration of methylprednisolone as risk factors for cytomegalovirus disease after liver transplantation Journal of Infectious Diseases 182 2000 1610 1615 2 L Halme K. Hockerstedt I. Lautenschlager Cytomegalovirus infection and development of biliary complications after liver transplantation Transplantation 75 2003 1853 1858 3 I. Lautenschlager L. Halme K. Hockerstedt L. Krogerus E. Taskinen Cytomegalovirus infection of the liver transplant: virological, histological, immunological, and clinical observations Transplant Infectious Disease 8 2006 21 30 4 A.P. Limaye R. Bakthavatsalam H.W. Kim C.S. Kuhr J.B. Halldorson P.J. Healey Late-onset cytomegalovirus disease in liver transplant recipients despite antiviral prophylaxis Transplantation 78 2004 1390 1396 5 C. La Rosa A.P. Limaye A. Krishnan J. Longmate D.J. Diamond Longitudinal assessment of cytomegalovirus (CMV)-specific immune responses in liver transplant recipients at high risk for late CMV disease Journal of Infectious Diseases 195 2007 633 644 6 V.C. Emery C.A. Sabin A.V. Cope D. Gor A.F. Hassan-Walker P.D. Griffiths Application of viral-load kinetics to identify patients who develop cytomegalovirus disease after transplantation Lancet 355 2000 2032 2036 7 A.P. Limaye L. Corey D.M. Koelle C.L. Davis M. Boeckh Emergence of ganciclovir-resistant cytomegalovirus disease among recipients of solid-organ transplants Lancet 356 2000 645 649 8 A.J. Eid S.K. Arthurs P.J. Deziel M.P. Wilhelm R.R. Razonable Emergence of drug-resistant cytomegalovirus in the era of valganciclovir prophylaxis: therapeutic implications and outcomes Clinical Transplantation 22 2008 162 170 9 I. Lautenschlager CMV infection, diagnosis and antiviral strategies after liver transplantation Transplant International 22 2009 1031 1040 10 H.R. Rosen C.L. Corless J. Rabkin S. Chou Association of cytomegalovirus genotype with graft rejection after liver transplantation Transplantation 66 1998 1627 1631 11 E. Puchhammer-Stockl I. Gorzer A. Zoufaly P. Jaksch C.C. Bauer W. Klepetko Emergence of multiple cytomegalovirus strains in blood and lung of lung transplant recipients Transplantation 81 2006 187 194 12 I. Gorzer C. Guelly S. Trajanoski E. Puchhammer-Stockl Deep sequencing reveals highly complex dynamics of human cytomegalovirus genotypes in transplant patients over time Journal of Virology 84 2010 7195 7203 13 P.D. Griffiths M. Ait-Khaled C.P. Bearcroft D.A. Clark A. Quaglia S.E. Davies Human herpesviruses 6 and 7 as potential pathogens after liver transplant: prospective comparison with the effect of cytomegalovirus Journal of Medical Virology 59 1999 496 501 14 R.L. Thomasini A.M. Sampaio S.H. Bonon I.F. Boin L.S. Leonardi M. Leonardi Detection and monitoring of human herpesvirus 7 in adult liver transplant patients: impact on clinical course and association with cytomegalovirus Transplantation Proceedings 39 2007 1537 1539 15 V.C. Emery A.F. Hassan-Walker A.K. Burroughs P.D. Griffiths Human cytomegalovirus (HCMV) replication dynamics in HCMV-naive and -experienced immunocompromised hosts Journal of Infectious Diseases 185 2002 1723 1728 16 R.L. Brady K. Green C. Frei P. Maxwell Oral ganciclovir versus valganciclovir for cytomegalovirus prophylaxis in high-risk liver transplant recipients Transplant Infectious Disease 11 2009 106 111 17 J.M. Park K.D. Lake J.D. Arenas R.J. Fontana Efficacy and safety of low-dose valganciclovir in the prevention of cytomegalovirus disease in adult liver transplant recipients Liver Transplantation 12 2006 112 116 [erratum appears in Liver Transpl 2006 March;12(3):494] 18 N. Singh C. Wannstedt L. Keyes D. Mayher L. Tickerhoof M. Akoad Valganciclovir as preemptive therapy for cytomegalovirus in cytomegalovirus-seronegative liver transplant recipients of cytomegalovirus-seropositive donor allografts Liver Transplantation 14 2008 240 244 19 D. Seehofer N. Rayes U.P. Neumann H. Meisel H. Oettle N.C. Nussler Changing impact of cytomegalovirus in liver transplantation—a single centre experience of more than 1000 transplantations without ganciclovir prophylaxis Transplant International 18 2005 941 948 20 G. Gerna D. Lilleri A. Callegaro A. Goglio S. Cortese P. Stroppa Prophylaxis followed by preemptive therapy versus preemptive therapy for prevention of human cytomegalovirus disease in pediatric patients undergoing liver transplantation Transplantation 86 2008 163 166 21 T. Shah W.K. Lai D. Mutimer Impact of targeted oral ganciclovir prophylaxis for transplant recipients of livers from cytomegalovirus-seropositive donors Transplant Infectious Disease 7 2005 57 62 22 H. Wiltshire C.V. Paya M.D. Pescovitz A. Humar E. Dominguez K. Washburn Pharmacodynamics of oral ganciclovir and valganciclovir in solid organ transplant recipients Transplantation 79 2005 1477 1483 23 M.A. Jacobson Ganciclovir therapy for severe cytomegalovirus infection in immunocompetent patients Clinical Infectious Diseases 25 1997 1487 1488 24 J.M. Iwasenko G.M. Scott J. Zeigler W.D. Rawlinson Emergence and persistence of multiple antiviral-resistant CMV strains in a highly immunocompromised child Journal of Clinical Virology 40 2007 152 155 25 D. Seehofer H. Meisel N. Rayes A. Stein J.M. Langrehr U. Settmacher Prospective evaluation of the clinical utility of different methods for the detection of human cytomegalovirus disease after liver transplantation American Journal of Transplantation 4 2004 1331 1337 26 A. Jain M. Orloff R. Kashyap K. Lansing R. Betts R. Mohanka Does valganciclovir hydrochloride (valcyte) provide effective prophylaxis against cytomegalovirus infection in liver transplant recipients? Transplantation Proceedings 37 2005 3182 3186 27 A.P. Limaye G. Raghu D.M. Koelle J. Ferrenberg M.L. Huang M. Boeckh High incidence of ganciclovir-resistant cytomegalovirus infection among lung transplant recipients receiving preemptive therapy Journal of Infectious Diseases 185 2002 20 27 28 S.M. Bhorade N.S. Lurain A. Jordan J. Leischner J. Villanueva R. Durazo Emergence of ganciclovir-resistant cytomegalovirus in lung transplant recipients Journal of Heart and Lung Transplantation 21 2002 1274 1282 29 J.M. Iwasenko G.M. Scott Z. Naing A.R. Glanville W.D. Rawlinson Diversity of antiviral resistant human cytomegalovirus in heart and lung transplant recipients Transplant Infectious Disease 13 2011 145 153 30 D. Boutolleau C. Deback C. Bressollette-Bodin S. Varnous N. Dhedin B. Barrou Resistance pattern of cytomegalovirus (CMV) after oral valganciclovir therapy in transplant recipients at high-risk for CMV infection Antiviral Research 81 2009 174 179 31 K. Schaffer J. Moran M. Duffy A.P. McCormick W.W. Hall J. Hassan Kinetics of host immune responses and cytomegalovirus resistance in a liver transplant patient Liver Transplantation 15 2009 1199 1203 32 G. Halwachs-Baumann M. Wilders-Truschnig G. Enzinger M. Eibl W. Linkesch H.J. Dornbusch Cytomegalovirus diagnosis in renal and bone marrow transplant recipients: the impact of molecular assays Journal of Clinical Virology 20 2001 49 57 33 S.C. Munro B. Hall L.R. Whybin L. Leader P. Robertson G.T. Maine Diagnosis of and screening for cytomegalovirus infection in pregnant women Journal of Clinical Microbiology 43 2005 4713 4718 34 D. Tarrago C. Quereda A. Tenorio Different cytomegalovirus glycoprotein B genotype distribution in serum and cerebrospinal fluid specimens determined by a novel multiplex nested PCR Journal of Clinical Microbiology 41 2003 2872 2877 35 G.M. Scott M.A. Isaacs F. Zeng A.M. Kesson W.D. Rawlinson Cytomegalovirus antiviral resistance associated with treatment induced UL97 (protein kinase) and UL54 (DNA polymerase) mutations Journal of Medical Virology 74 2004 85 93 36 C.J. McIver C.F.H. Jacques S.S.W. Chow S.C. Munro G.M. Scott J.A. Roberts Development of multiplex PCRs for detection of common viral pathogens and agents of congenital infections Journal of Clinical Microbiology 43 2005 5102 5110 37 C. Manichanh C. Olivier-Aubron J.P. Lagarde J.T. Aubin P. Bossi A. Gautheret-Dejean Selection of the same mutation in the U69 protein kinase gene of human herpesvirus-6 after prolonged exposure to ganciclovir in vitro and in vivo Journal of General Virology 82 2001 2767 2776 38 S.K. Arthurs A.J. Eid R.A. Pedersen R.A. Dierkhising W.K. Kremers R. Patel Delayed-onset primary cytomegalovirus disease after liver transplantation Liver Transplantation 13 2007 1703 1709 39 K.T. Shiley L.B. Gasink T.D. Barton P. Pfeiffenberger K.M. Olthoff E.A. Blumberg Increased incidence of cytomegalovirus infection in high-risk liver transplant recipients receiving valganciclovir prophylaxis versus ganciclovir prophylaxis Liver Transplantation 15 2009 963 967 40 D. Kumar S. Chernenko G. Moussa I. Cobos O. Manuel J. Preiksaitis Cell-mediated immunity to predict cytomegalovirus disease in high-risk solid organ transplant recipients American Journal of Transplantation 9 2009 1214 1222 41 G. Nebbia F.M. Mattes C. Smith E. Hainsworth J. Kopycinski A. Burroughs Polyfunctional cytomegalovirus-specific CD4+ and pp65 CD8+ T cells protect against high-level replication after liver transplantation American Journal of Transplantation 8 2008 2590 2599